FiltersDone

Question type

Essay

Multiple Choice

Short Answer

True False

Matching

Exam 6: How Cells Read the Genome: From DNA to Protein

Show Answer

Share

---

All types

Filters

Study FlashcardsPractice ExamLearn

Question 21

Multiple Choice

Review LaterAdd Note

Review Later

Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?

A) Ribosome assembly
B) rRNA gene transcription
C) Telomerase assembly
D) tRNA processing
E) All of the above

F) C) and E)
G) A) and C)

Correct Answer

verified

Show Answer

Question 22

Multiple Choice

Review LaterAdd Note

Review Later

For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other.

A) 5'... UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU...3'
B) 5'... UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU...3'
C) 5'... UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA...3'
D) 5'... CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA...3'

E) A) and C)
F) All of the above

Correct Answer

verified

Show Answer

Question 23

Multiple Choice

Review LaterAdd Note

Which of the following types of noncoding RNA chiefly functions in the processing and chemical modification of ribosomal RNAs (rRNAs) ?

Which of the following better describes a typical, actively translated mRNA in its journey from the nucleus to the cytosol?

In the following representation of a single-stranded RNA molecule, the nucleotide residues are drawn as gray circles, while base-pairing interactions between them are indicated by dashed lines. The structure of this RNA molecule has...

Due to their high transcription rate, active ribosomal RNA (rRNA) genes can be easily distinguished in electron micrographs of chromatin spreads. They have a characteristic "Christmas tree" appearance, where the DNA template is the "trunk" of the tree and the nascent RNA transcripts form closely packed "branches." At the base of each branch is an RNA polymerase extending that branch, while RNA processing complexes at the tip of the branch form terminal "ornaments." The top of the tree represents the ... of the rRNA gene, and the "ornaments" are at the ... end of the nascent rRNA molecules.

After the first and before the second chemical step of RNA splicing, the intron of the pre-mRNA...

Sort the following events in the order that they occur during transcription initiation in Escherichia coli. Your answer would be a four-letter string composed of letters A to D only; e.g. DCAB. (A) Abortive initiation trials (B) ? Factor release from the RNA polymerase holoenzyme (C) Binding of the holoenzyme to the promoter in the "closed" complex (D) Formation of the transcription bubble

How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a protein that has been tagged for degradation with a polyubiquitin chain?

What is the function of the 19S cap in the proteasome complex?

An elongating ribosome is bound to appropriate tRNAs in both the A and the P sites and is ready for peptidyl transfer. What happens next?

Indicate true (T) and false (F) statements below regarding the accuracy of translation by the ribosome. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF. ( ) The difference in the binding affinity of a codon to a correct versus incorrect anticodon CANNOT by itself account for the high accuracy of translation. ( ) GTP hydrolysis by EF-Tu both speeds up translation and increases its accuracy. ( ) The ribosome can detect correct Watson-Crick base-pairing between the codon and anticodon in the A site, and consequently trigger GTP hydrolysis by EF-Tu. ( ) Even after GTP hydrolysis by EF-Tu, the ribosome can prevent wrong amino acid incorporation by kinetic proofreading.

In the following qualitative histogram, which two curves better correspond to human exon and intron length distributions, respectively?

Indicate true (T) and false (F) statements below regarding the RNA world hypothesis. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF. ( ) According to this hypothesis, RNA in primitive cells was responsible for storing genetic information, while proteins were responsible for the catalysis of chemical reactions. ( ) The existence of natural ribozymes supports this hypothesis. ( ) In support of this hypothesis, all peptides in present-day cells are made by the ribosome. ( ) All present-day cells use DNA as their hereditary material.

Each aminoacyl-tRNA synthetase activates a certain amino acid by attaching it to its corresponding tRNA(s) through a high-energy linkage...

Which of the following nucleotides is hydrolyzed in both transcription and in translation elongation?

As an mRNA molecule is processed in the nucleus, it loses some proteins and binds to new ones, some of which are used in mRNA surveillance pathways. The presence of which of the following molecules on an mRNA is a signal that the mRNA is still NOT ready for nuclear export?

The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT. 5?…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3?

Eukaryotic pre-mRNAs undergo a number of modifications such as capping at the 5' end. A 5' cap...

A primary mRNA transcript with three exons is depicted below. Which of the following mature mRNA products of this transcript is a result of exon skipping?